IDNLearn.com is your go-to platform for finding accurate and reliable answers. Ask anything and receive prompt, well-informed answers from our community of knowledgeable experts.
The DNA sequence shown below comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The underlined codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. The 5 'T on the top strand indicates nucleotide position one. . . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3' . . . AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG 5 A mutation that changes the nucleotide at position 25 from to T results in which of the following: . . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'
Sagot :
We appreciate your presence here. Keep sharing knowledge and helping others find the answers they need. This community is the perfect place to learn together. Find clear and concise answers at IDNLearn.com. Thanks for stopping by, and come back for more dependable solutions.
