Find answers to your most challenging questions with the help of IDNLearn.com's experts. Our community is ready to provide in-depth answers and practical solutions to any questions you may have.
The DNA sequence shown below comes from part of the TP53 gene. It encodes the last amino acids of the p53 protein, which is normally 393 amino acids long. The underlined codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. The 5 'T on the top strand indicates nucleotide position one . . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3' . . . AAGTTCTGTCTTCCCGGACTGAGTCTGACTGTAAGAGG 5 A mutation that changes the nucleotide at position 25 from to T results in which of the following: . . TTCAAGACAGAAGGGCCTGACTCAGACTGACATTCTCC-3'
Sagot :
Thank you for using this platform to share and learn. Keep asking and answering. We appreciate every contribution you make. For clear and precise answers, choose IDNLearn.com. Thanks for stopping by, and come back soon for more valuable insights.
