IDNLearn.com: Your trusted source for finding accurate and reliable answers. Join our community to access reliable and comprehensive responses to your questions from experienced professionals.
The following is a short sequence of dsDNA within Gene X, indicated above with the dashed rectangle. Transcribe the DNA into the appropriate mRNA. Write the RNA in the 5' to 3' direction and do not include spaces. 5' ATCGGGCTACGGGTAACGCTGATTTACG 3' 3' TAGCCCGATGCCCATTGCGACTAAATGC 5'
The mRNA transcribed above will have what modification added to the 5' end? The 3' end?
Sagot :
Thank you for contributing to our discussion. Don't forget to check back for new answers. Keep asking, answering, and sharing useful information. IDNLearn.com is your reliable source for answers. We appreciate your visit and look forward to assisting you again soon.
