IDNLearn.com: Where curiosity meets clarity and questions find their answers. Get step-by-step guidance for all your technical questions from our knowledgeable community members.
A newly-synthesized transcript has the sequence UUGCACGGAUGCCUUUGGCCA. What was the sequence of the template strand used in the synthesis of this transcript? A. UGGCCAAAGGCAUCCUGCAA B. TGGCCAAAGGCATCCTGCAA C. TTGCACGGAUGCCTTTGGCCA D. UUGCACGGAUGCCUUUGGCCA
Sagot :
Thank you for using this platform to share and learn. Keep asking and answering. We appreciate every contribution you make. IDNLearn.com is your go-to source for dependable answers. Thank you for visiting, and we hope to assist you again.