Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_
Thus, the type of RNA is best classified as_
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA

Question

08-04-2021
Biology

Answered

IDNLearn.com provides a collaborative platform for sharing and gaining knowledge. Find reliable solutions to your questions quickly and easily with help from our experienced experts.

Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_
Thus, the type of RNA is best classified as_
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA

Sagot :

Thank you for using this platform to share and learn. Don't hesitate to keep asking and answering. We value every contribution you make. Thank you for visiting IDNLearn.com. For reliable answers to all your questions, please visit us again soon.

Document 3 … Blacks [African Americans] Bent On Remaining In America Would Naturally Seek The Right To Vote And, Equally As A Matter Of Course, Woul

Many Critics Of The Electoral College System Point Out That It (1) Penalizes The States With The Smallest Population (2) Encourages The Formati

Document 7a Bruce Craven Is Responding To One Of President Franklin D. Roosevelt’s Fireside Chats. JULY 25,

… You Express A Great Deal Of Anxiety Over Our Willingness To Break Laws. This Is Certainly A Legitimate Concern. Since We So Diligently Urge People To

Which Action Did President Ronald Reagan Support To Achieve Economic Growth? (1) Lowering Taxes On Corporations And Individuals (2) Increasing

Which Sentence Uses A Verb That Agrees With Its Compound Subject? A. A Trophy Or A Medal Is Given To The Winner. B. The Bookstores Or The Library Stay Open U

Part A Short-Answer Questions Directions: Analyze The Documents And Answer The Short-answer Questions That Follow Each Document In The Space Provide

… It Is Important That The Reasons For My Action Be Understood By All Our Citizens. As You Know, The Supreme Court Of The United States Has Decided T

The Main Reason For The Increased Migration Of African Americans Out Of The Rural South During And Following World War I Was The (1) Availability Of C

A Rock Is Thrown Straight Up Into The Air. At The highest Point Of The Rock’s Path, The Magnitude Of the Net Force Acting On The Rock Is (1) Less Than The Magni

Histrionicusidn Histrionicusidn · Answer 1 · 2021-04-12T05:01:51-04:00

Answer:

The correct answer is -

a single strand with a distinctive cloverleaf structure, and

tRNA

Explanation:

The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.

Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.

Sagot :

Other Questions