Answered

Get personalized answers to your unique questions on IDNLearn.com. Our Q&A platform offers reliable and thorough answers to ensure you have the information you need to succeed in any situation.

The mRNA generated below was produced in the
of the cell.
5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'

Sagot :

Histrionicusidn

The mRNA generated below was produced in the  nucleus of the cell.

Messenger RNA or mRNA is a type of RNA that is an essential component of protein synthesis or gene expression. It is synthesized using the template that is the nucleotide sequence of DNA.

  • The synthesis of the mRNA s called transcription
  • The nucleus is the location of the production of mRNA in eukaryotic cells from linear DNA strands.
  • It requires nucleotide triphosphates as substrates
  • catalyzed by the enzyme RNA polymerase II.

Thus, the process of making mRNA from DNA is called transcription, and it occurs in the nucleus.

Learn more about transcription:

https://brainly.com/question/11430054

We value your presence here. Keep sharing knowledge and helping others find the answers they need. This community is the perfect place to learn together. Thanks for visiting IDNLearn.com. We’re dedicated to providing clear answers, so visit us again for more helpful information.