Answered

Connect with a community that values knowledge and expertise on IDNLearn.com. Join our Q&A platform to get accurate and thorough answers to all your pressing questions.

Which mrna sequences would form a structure that is a cue for transcription termination of some genes?

Sagot :

Mhernandez92182idn

Answer:

First, you must know what the stop codons are: UAA, UAG, and UGA

Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed

Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"

Explanation:

ShivjimishraVTidn

Those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

What do you mean by Transcription?

Transcription may be defined as the process by which the information in a strand of DNA is copied into a new molecule of messenger RNA (mRNA).

Stop codons are responsible for the termination of transcription of almost all the genes. They are necessary for inhibiting the excessive expression of some genes.

Therefore, those mRNA sequences that consist of the stop codons like UAA, UGA, and UAG would form a structure that is a cue for transcription termination of some genes.

To learn more about Transcription, refer to the link:

https://brainly.com/question/1048150

#SPJ4

We are delighted to have you as part of our community. Keep asking, answering, and sharing your insights. Together, we can create a valuable knowledge resource. Find clear and concise answers at IDNLearn.com. Thanks for stopping by, and come back for more dependable solutions.