T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Question

03-04-2022
Biology

Answered

Join the IDNLearn.com community and get your questions answered by knowledgeable individuals. Our community is here to provide the comprehensive and accurate answers you need to make informed decisions.

T A C G T G G A C T G A G G A C T C C T C is this a 'sense' strand or 'antisense' strand?

Sagot :

Thank you for participating in our discussion. We value every contribution. Keep sharing knowledge and helping others find the answers they need. Let's create a dynamic and informative learning environment together. Your questions are important to us at IDNLearn.com. Thanks for stopping by, and come back for more reliable solutions.

Which Of The Following Computerized Charting Forms, Used In-home Care, Records Actions Related To ADL & Home Support By Placing The PSW Initials In The Appr

Question 13 Of 20:Which Of The Following Is Not A Condition Under Which The Malfunction Indicator Light (MIL) Or Service Engine Light Is Turned Off?A. DTCs Are

The Afrikaner Population Justified Apartheid By Claiming That:a) God Desired The Races To Be Separateb) Belief In Racial Equalityc) Advocacy For Racial Integrat

A Store Is Offering [tex]$25 \%$[/tex] Off All Shoes. Declan Purchases Shoes And Clothes. The Expression Representing His Total Cost (including [tex]$8 \%$[/tex

Where Was The First Anti-slavery Society In The History Of The World Formed In 1775?A. LondonB. ParisC. PhiladelphiaD. Jerusalem

What Changes In American Society Have Led To Broader And More Accurate Representations Of People With Diverse Backgrounds?

Select The Correct Answer.What Is The [tex]$n$[/tex]th Term Of The Geometric Sequence That Has A Common Ratio Of 6 And 24 As Its Third Term?A. [tex]$a_n = 24(6)

A Food Delivery Driver Can Make 21 Deliver's During A 7 Hour Shift How Many Delivery's Per Hour.

What Is [tex]\frac{\sqrt{25 X^2 Y^2}}{\sqrt{x Y}}[/tex] In Simplest Form? Assume [tex]x \geq 0[/tex] And [tex]y[/tex].A. [tex]5 \sqrt{x Y}[/tex] B. [tex]25 \sq

The Diameter Of One Circle Is Represented By [tex]12x[/tex]. The Diameter Of Another Circle Is Represented By [tex]6x^2y[/tex]. What Is The Ratio Of The Radii O

Luisvaschettoidn Luisvaschettoidn · Answer 1 · 2022-04-08T04:27:10-04:00

The information provided is NOT sufficient to indicate if the TACGTGGACTGAGGACTCCTC sequence is a 'sense' strand or 'antisense' strand.

What is a sense DNA strand?

DNA is a double helix molecule composed of two long chains of nucleotides linked by hydrogen bonds.

During transcription, the sense DNA strand is actively used as template to produce a complementary RNA molecule.

In consequence, it is required to know the sequence of the resulting RNA to determine if the sequence above belongs to a 'sense' strand or 'antisense' strand.

Learn more about transcription here:

https://brainly.com/question/1048150

Sagot :

What is a sense DNA strand?

Other Questions