if the relationship between total cost and number of units made is linear, and if cost increased by $3 for each additional unit made, and if the total cost of 10 units is $30, find the equation of the relationship between total cost (y) and number of units made (x)

Question

01-12-2022
Mathematics

Answered

Get comprehensive answers to your questions with the help of IDNLearn.com's community. Join our platform to receive prompt and accurate responses from experienced professionals in various fields.

if the relationship between total cost and number of units made is linear, and if cost increased by $3 for each additional unit made, and if the total cost of 10 units is $30, find the equation of the relationship between total cost (y) and number of units made (x)

Sagot :

Your presence in our community is highly appreciated. Keep sharing your insights and solutions. Together, we can build a rich and valuable knowledge resource for everyone. Find clear answers at IDNLearn.com. Thanks for stopping by, and come back for more reliable solutions.

Write [tex]$ H(x) = \frac{4}{3 - \sqrt{4 + X^2}} $[/tex] As The Composition Of Two Functions In The Form [tex]$ (f \circ G)(x) $[/tex].Select The Correct An

Explain What Scholarship As Conversation Means

Physician Assistance Provide Diagnostic, Therapeutic, And Preventive Health Care While Working Under The Supervision If A What

Here Is The Published Sequence For The Portion Of The PTC Gene That You Will Amplify Today.5’- CCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAGGCGGCCACTGAGCAACAGTGATTGT

Identifica La Alternativa Incorrecta Respecto A La Respiración:A) Libera Energía B) Libera CO2 Y H₂O C) Requiere O2 D) Ocurre En Presencia De Luz Y En La Osc

Which Ordered Pair Makes Both Inequalities True?[tex]\[ \begin{array}{l} y \ \textgreater \ -2x + 3 \\ y \leq X - 2 \end{array} \][/tex]

Akbar Most Helped Non-Muslims By ending Taxes They Had To Pay. creating A Code Of Law. creating His Own Religion. paying Fair Wages For Work.

It Took Mike 5.625 Hours To Travel Over Pack Ice From One Town In The Arctic To Another Town 180 Miles Away. During The Return Journey, It Took Him 10 Hours. As

Julia Is A New Teacher Who Wants To See Her Students Succeed. However, Her Mentor Has Warned Her That She May Cause Students To Experience Difficulties If She H

Which Of The Following Does NOT Support The Arousal Level Theory Of ADHD?Group Of Answer Choicesa. ADHD Diagnosis Decreases From Childhood To Adolescence.b. Sti

BhawnaKumariidn BhawnaKumariidn · Answer 1 · 2022-12-06T04:05:10-05:00

The relation between the total cost y and the number of units made x is

y = 3x.

What is an equation?

An equation is a mathematical statement that proves two mathematical expressions are equal in algebra, and this is how it is most commonly used. In the equation 3x + 5 = 14, for instance, the two expressions 3x + 5 and 14 are separated.

Given:

The cost (the price) of each single item is $3 and the cost of 10 units is $30.

So, the relation between the total cost y and the number of units made x is

y = 3x.

To learn more about the equation from the given link

https://brainly.com/question/28218072

#SPJ4

Sagot :

Other Questions