how did many europeans react to the outbreal of war in august 1914

Question

30-05-2015
Social Studies

Answered

Experience the power of community-driven knowledge on IDNLearn.com. Discover in-depth and reliable answers to all your questions from our knowledgeable community members who are always ready to assist.

how did many europeans react to the outbreal of war in august 1914

Sagot :

Your engagement is important to us. Keep sharing your knowledge and experiences. Let's create a learning environment that is both enjoyable and beneficial. Your questions deserve precise answers. Thank you for visiting IDNLearn.com, and see you again soon for more helpful information.

Simplify The Following Expression:[tex]\[ 5de^2 + 4de^2 + (-6de^2) \][/tex]

When Developing New Workflow Processes Using A Systems Approach, The Work Of Patient Care Or Specific Tasks Often Shift From One Department To Another. While Th

Before Beginning A Work Of Nonfiction, You Should Preview TheA. Visuals And VocabularyB. HeadingsC. IntroductionD. End-of-chapter QuestionsE. All These Answers

Consider The Chemical Equation Below.[tex]\[ \text{Mg(OH)}_2 + 2 \text{HNO}_3 \longrightarrow \text{Mg(NO}_3\text{)}_2 + 2 \text{H}_2 \text{O} \][/tex]Which I

Mrs. A, A Patient In The Infusion Clinic, Requested Her Husband Be Present When She Is Informed About Her Care At Home, Including Medications, Diet, Therapy, An

Two Friends, John And Sarah, Have Restricted Permission To Share Their Ages. John Is 10 Years Older Than Sarah. If Their Combined Age Is 50 Years, How Old Is Sa

Solve The Inequality [tex]$x^3 - 7x^2 + 10x \ \textless \ 0$[/tex].A. [tex]$(-\infty, 0) \cup (2,5)$[/tex]B. [tex][tex]$(-\infty, 0] \cup [2,5]$[/tex][/tex]C.

Create PCR Primers For The Following DNA Sequence: 5' AGCTAGACGAGTACGTATCGCAGTAACGC 3'"

The Objectives Of An Effective System Of Corporate Governance Include All Of The Following Except: A. Ensure That The Assets Of The Company Are Used Efficiently

How Will Taking Ownership In Communication Most Likely Improve A Relationship?A. By Showing EmpathyB. By Promoting HonestyC. By Establishing DominanceD. By Prev

WorldCitizenidn WorldCitizenidn · Answer 1 · 2015-05-31T06:14:19-04:00

WorldCitizenidn WorldCitizenidn

31-05-2015

At the beginning of the great war, many people were actually enthusiastic about the war (and at least supported it), which was fuelled by nationalism ( and the desire to prove themselves better than other nations) and perhaps hopes for territory gain; at the time it was not known that the Great War would come with such a great loss of life.

Answer Link

Sagot :

Other Questions