Please write out the amino acid sequence that would ultimately be produced from the following sequence of DNA:

TGTTACATACCGTTTATTGGT

Hint: Write the three-letter code for the amino acid followed by a space. For example: Met Pro Arg Met. (Note: Met Pro Arg Met is not the right answer to this question.)

Question

21-07-2024
Biology

Answered

Find answers to your most challenging questions with the help of IDNLearn.com's experts. Our platform offers comprehensive and accurate responses to help you make informed decisions on any topic.

Please write out the amino acid sequence that would ultimately be produced from the following sequence of DNA:

TGTTACATACCGTTTATTGGT

Hint: Write the three-letter code for the amino acid followed by a space. For example: Met Pro Arg Met. (Note: Met Pro Arg Met is not the right answer to this question.)

Sagot :

We appreciate your presence here. Keep sharing knowledge and helping others find the answers they need. This community is the perfect place to learn together. Thank you for choosing IDNLearn.com. We’re dedicated to providing clear answers, so visit us again for more solutions.

Jordan Took A Business Trip From New York To Denver. She Spent Two Days In Travel, Conducted Business For Nine Days, And Visited Friends For Five Days. She Incu

Un Objeto De 10 Kg Se Deja Caer Desde Una Altura De 100 M. Considerando Que La Aceleración De La Gravedad Es [tex]$g = 9.8 \, M/s^2$[/tex], Calcule:A. La Veloci

Given [tex]\[ P = \begin{bmatrix} 1 & X \\ 3 & 4 \end{bmatrix} \][/tex]and [tex]\[ Q = \begin{bmatrix} 5 & X^2 \\ 3x & 11 \end{bmatrix} \][/tex]

Type The Correct Answer In The Box.Calculate The Mass Of The Object. Use [tex]$m=\frac{2 KE}{v^2}$[/tex].Matthew Rolls A Bowling Ball With A Speed Of 2 Meters/s

What Is The Highest Temperature Allowed For Cold-holding Fresh Salsa?a. [tex]32^{\circ} F \left(0^{\circ} C \right)[/tex]b. [tex]38^{\circ} F \left(3^{\circ} C

What Were Some Of The Causes Of The War Of 1812 With The British?Select One Or More:A. The British Invaded New OrleansB. British Impressment Of American Sailors

A. [tex]8 + (6 + 5) = (6 + 8) + 5[/tex]c. [tex](4 + 5) + 2 = (2 + 5) + 4[/tex]d. [tex]9 + (5 + 10) = \square + (9 + 5)[/tex]

1. Draw Oblique And Isometric Sketches Of The Following:(a) A Cuboid Of Dimensions [tex]$6 \, \text{cm} \times 3 \, \text{cm} \times 4 \, \text{cm}$[/tex]

9. Find The Squares Of The Following Numbers By Using The Formula Of [tex](a+b)^2[/tex] Or [tex](a-b)^2[/tex].a) 49 B) 51 C) 99 D) 101 E) 999 F) 1001

Differentiate [tex]$-\cot^2 X$[/tex].

GinnyAnsweridn GinnyAnsweridn · Answer 1 · 2024-07-21T14:02:07-04:00

Final answer:

Transcribing the given DNA sequence and translating it into amino acids results in the sequence Thr-Met-Cys-Ala-Ile-Thr.

Explanation:

To determine the amino acid sequence from the given DNA sequence TGTTACATACCGTTTATTGGT, we need to transcribe it into mRNA and then translate it into amino acids. The given DNA sequence would transcribe to mRNA as ACAAUGUAUGGCCAAUAACCA. Referencing the genetic code, this mRNA sequence codes for the amino acid sequence Thr-Met-Cys-Ala-Ile-Thr.

Learn more about Amino acid sequence determination from DNA sequence here:

https://brainly.com/question/44008902

Sagot :

Final answer:

Explanation:

Learn more about Amino acid sequence determination from DNA sequence here:

Other Questions